View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_28 (Length: 369)
Name: NF0342_2D_low_28
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0342_2D_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 48144075 - 48144035
Alignment:
Q |
22 |
acttttaaacaagtgtcccaagagcacttgttagcattttc |
62 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48144075 |
acttttaaacaagtgtcccaagagcacttgttagcattttc |
48144035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University