View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_36 (Length: 357)
Name: NF0342_2D_low_36
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 13 - 333
Target Start/End: Complemental strand, 6721894 - 6721574
Alignment:
| Q |
13 |
catcaccaccatgatcacagtttcgatctataactagnnnnnnnnnncttcaaagttttttgagagtgaaaatgttggaggcaatggaaagttcagtgaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6721894 |
catcaccaccatgatcacagtttcgatctataactagtttattttttcttcaaagttttttgagagtgaaaatgttggaggcaatggaaagttcagtgaa |
6721795 |
T |
 |
| Q |
113 |
tggtggattttcacaacattttcaaagctttgttggagatagtagtgaagaagaactttctgtgcttcctcgtcataccaaagttgttgttactggaaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6721794 |
tggtggattttcacaacattttcaaagctttgttggagatagtagtgaagaagaactttctgtgcttcctcgtcataccaaagttgttgttactggaaat |
6721695 |
T |
 |
| Q |
213 |
aaccgtactaaatctgttcttgttggtcttcgtggtgttgttaagaaagctgttggtcttggtggttggcattggctggtaattttctcaatcaatttca |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6721694 |
aaccgtactaaatctgttcttgttggtcttcgtggtgttgttaagaaagctgttggtcttggtggttggcattggctggtaattttctcaatcaatttca |
6721595 |
T |
 |
| Q |
313 |
ctttttttatcatcaaaattg |
333 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6721594 |
ctttttttatcatcaaaattg |
6721574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 150 - 294
Target Start/End: Complemental strand, 52220913 - 52220769
Alignment:
| Q |
150 |
gatagtagtgaagaagaactttctgtgcttcctcgtcataccaaagttgttgttactggaaataaccgtactaaatctgttcttgttggtcttcgtggtg |
249 |
Q |
| |
|
|||||||||||||| ||||| |||||| | ||||||||||| || |||||||||||||||||||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
52220913 |
gatagtagtgaagaggaactgtctgtgttacctcgtcatactaaggttgttgttactggaaataaccgtacaaaatcggttcttgttggtcttcaaggtg |
52220814 |
T |
 |
| Q |
250 |
ttgttaagaaagctgttggtcttggtggttggcattggctggtaa |
294 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
52220813 |
ttgttaagaaagctgttggattaggtggttggcattggctggtaa |
52220769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University