View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_37 (Length: 342)
Name: NF0342_2D_low_37
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 323
Target Start/End: Complemental strand, 154803 - 154498
Alignment:
| Q |
18 |
tatatcgccacgaagaaaattatgagacttgatagctgaaatccggtgttagcagaggcggagccatcattgaataggctgcggatggcatcgtcgttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154803 |
tatatcgccacgaagaaaattatgagacttgatagctgaaatccggtgttagcagaggcggagccatcattgaataggctgcggatggcatcgtcgttgg |
154704 |
T |
|
| Q |
118 |
tagtgaaaaatagagagctgagatcattgtagtggtttggtggacactgaaaattgtcgtagtgtattgagaagcctccggttggggagctgggacactc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154703 |
tagtgaaaaatagagagctgagatcattgtagtggtttggtggacactgaaaattgtcgtagtgtattgagaagcctccggttggggagctgggacactc |
154604 |
T |
|
| Q |
218 |
ccctggacatggcacacactttgatagcaatggaagcccaaatcgaatacaggaggttacaaacgagataatcatcaccagtagaatcttgaatattgga |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
154603 |
ccctggacatggcacacactttgatagcaatggaagcccaaatcgaatacaggaggttacaaacgagataatcatcaccagcagaatcttgaatattgga |
154504 |
T |
|
| Q |
318 |
cctctc |
323 |
Q |
| |
|
|||||| |
|
|
| T |
154503 |
cctctc |
154498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University