View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_39 (Length: 341)
Name: NF0342_2D_low_39
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 19 - 325
Target Start/End: Original strand, 36885500 - 36885806
Alignment:
| Q |
19 |
aatcctacaaatctgtaagtgggagttcggccaggtaggcaactgatccagtgaatttgttactatgcaagaacctgcaaataagcaccaattttcagat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36885500 |
aatcctacaaatctgtaagtgggagttcggccaggtaggcaactgatccagtgaatttgttactatgcaagaacctgcaaataagcaccaattttcagat |
36885599 |
T |
 |
| Q |
119 |
caaaccaacagacccctataaacaaaagttcttcctttcaaaattgagtatacaatgatacgtaaatcaagtttagcgaaaataagacataggaaggaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36885600 |
caaaccaacagacccctataaacaaaagttcttcctttcaaaattgagtatacaatgatacgtaaatcaagtttagcgaaaataagacataggaaggaag |
36885699 |
T |
 |
| Q |
219 |
aaatttacagtctggcaaggtttgtcaaggaaccaaatgatcttggtagatctcctgagaagttattgtacgaaaggtccctgaagaaaggaaatcaccc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36885700 |
aaatttacagtctggcaaggtttgtcaaggaaccaaatgatcttggtagatctcctgagaagttattgtacgaaatgtccctgaagaaaggaaatcaccc |
36885799 |
T |
 |
| Q |
319 |
gttgtga |
325 |
Q |
| |
|
||||||| |
|
|
| T |
36885800 |
gttgtga |
36885806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 307
Target Start/End: Original strand, 22556192 - 22556284
Alignment:
| Q |
215 |
gaagaaatttacagtctggcaaggtttgtcaaggaaccaaatgatcttggtagatctcctgagaagttattgtacgaaaggtccctgaagaaa |
307 |
Q |
| |
|
||||||| ||||| ||| |||||||| |||||||||||||||| ||||| |||||||| | ||| ||||| || ||||||||||||| |||| |
|
|
| T |
22556192 |
gaagaaacttacaatctatcaaggtttatcaaggaaccaaatgaacttggcagatctccagtgaaattattataagaaaggtccctgatgaaa |
22556284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University