View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_49 (Length: 306)
Name: NF0342_2D_low_49
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 61 - 303
Target Start/End: Original strand, 154825 - 155067
Alignment:
| Q |
61 |
cggtgttgccattccctctggactcttcattcccgtcatacttgctggagcttcttacgggcgtcttatagggactgtgatggctccattcacagctctt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154825 |
cggtgttgccattccctctggactcttcattcccgtcatacttgctggagcttcttacgggcgtcttatagggactgtgatggctccattcacagctctt |
154924 |
T |
 |
| Q |
161 |
gatacgggtttgtttgctctccttggagccgcatctttccttggtggcacgatgagaatgacagtttctctatgtgtcatacttcttgaactcactaata |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154925 |
gatacgggtttgtttgctctccttggagccgcatctttccttggtggcacgatgagaatgacagtttctctatgtgtcatacttcttgaactcactaata |
155024 |
T |
 |
| Q |
261 |
acttgttgatgctaccattggtcatgttggttctcttcatttc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
155025 |
acttgttgatgctaccattggtcatgttggttctcctcatttc |
155067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 154803 - 154754
Alignment:
| Q |
18 |
tatatcgccacgaagaaaattatgagacttgatagctgaaatccggtgtt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154803 |
tatatcgccacgaagaaaattatgagacttgatagctgaaatccggtgtt |
154754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 166 - 300
Target Start/End: Complemental strand, 56469624 - 56469490
Alignment:
| Q |
166 |
gggtttgtttgctctccttggagccgcatctttccttggtggcacgatgagaatgacagtttctctatgtgtcatacttcttgaactcactaataacttg |
265 |
Q |
| |
|
|||||||||||| || | || || ||||| |||||||||||||| ||||||||||| || ||| | |||||||| ||||| ||||| ||||| ||| | |
|
|
| T |
56469624 |
gggtttgtttgcacttttgggtgctgcatccttccttggtggcacaatgagaatgactgtctctttgtgtgtcattcttctcgaacttactaacaacctc |
56469525 |
T |
 |
| Q |
266 |
ttgatgctaccattggtcatgttggttctcttcat |
300 |
Q |
| |
|
| |||||||||||||||||||| |||||| |||| |
|
|
| T |
56469524 |
ctcatgctaccattggtcatgttagttctcctcat |
56469490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University