View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_54 (Length: 306)
Name: NF0342_2D_low_54
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 24858616 - 24858328
Alignment:
| Q |
1 |
tgtttacataccgaacattctcacatgttgcagtagttccaccaccaccttctggttctaaaatcacatcctgcaagtatatttctctgcaaggaacgcg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24858616 |
tgtttacatatcgaacattctcacatgttgcagtagttccaccaccaccttctggttctaaaatcacatcctgcaagtatatttctctgcaaggaacgct |
24858517 |
T |
 |
| Q |
101 |
tcggctgcaattaaatttgatcgctatttccgaagcactcgttcctctgatgttttggtacaaaacctggcttaattgcacggctttggtccgctcttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
24858516 |
tcggctgcaattaaatttgatcgctatttccgaagcactcgttcctctgatgttttggtacaaaacttggcttaattgcacggctttgttccgctcttgg |
24858417 |
T |
 |
| Q |
201 |
catggctctgtttgatcacagtagtattgatctatgattacgggatttgtcacattttgcatttttatgttcataaatttgatgtttct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24858416 |
catggctctgtttgatcacagtagtattgatctatgattacgggatttgtcacattttgcatttttatgttcataaatttgatgtttct |
24858328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 289
Target Start/End: Complemental strand, 9674057 - 9673995
Alignment:
| Q |
227 |
ttgatctatgattacgggatttgtcacattttgcatttttatgttcataaatttgatgtttct |
289 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
9674057 |
ttgatctatgattatgggattagtcacatttcgcacaactatgttgataaatttgatgtttct |
9673995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University