View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_63 (Length: 259)
Name: NF0342_2D_low_63
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 80 - 245
Target Start/End: Complemental strand, 39166102 - 39165937
Alignment:
| Q |
80 |
ggttctacttctagtgtttgtttggatgtagatgctaacaacatagttgtcaccaatagttgcaaatgtattagcaaagttaacacatgtgaccctgcaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166102 |
ggttctacttctagtgtttgtttggatgtagatgctaacaacatagttgtcaccaatagttgcaaatgtattagcaaagttaacacatgtgaccctgcaa |
39166003 |
T |
 |
| Q |
180 |
gccaatggttcaaacttgttgacagtacaagaaagttgaactgaagattatctatagatttgatgt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166002 |
gccaatggttcaaacttgttgacagtacaagaaagttgaactgaagattatctatagatttgatgt |
39165937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 39166415 - 39166496
Alignment:
| Q |
1 |
ttacgaatccacacaaacgcatattctaaaaaagatgaagggtgtataaagaatgtgaggcatcggtggagatgtacacggt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166415 |
ttacgaatccacacaaacgcatattctaaaaaagatgaagggtgtataaagaatgtgaggcatcggtggagatgtacacggt |
39166496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University