View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_67 (Length: 254)
Name: NF0342_2D_low_67
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_67 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 48746747 - 48746530
Alignment:
| Q |
17 |
cattatccagttatgacatgtgctttgtttgattatgaacatcttgttgtgtggaccaggttatgtgctatcattgtagtactgttagacattagtagcg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48746747 |
cattatccagttatgacatgtgctttgtttgattatgaacatcttgttgtgtggaccaggttatgtgctatcattgtagta----------------gcg |
48746664 |
T |
 |
| Q |
117 |
ggagaaaagaaagaaggaagggggccatgcattatgcaaatggtatatgttttgtactcgatggatggattaagggtgatgtcatttggagaaaacttgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48746663 |
ggagaaaagaaagaaggaagggggccatgcattatgcaaattgtatatgttttgtactcgatggat----taagggtgatgtcatttggagaaaacttgc |
48746568 |
T |
 |
| Q |
217 |
actttagaaaaatgtagggtttaaaaataataattggc |
254 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48746567 |
actttagaaaaatgcagggtttaaaaataataattggc |
48746530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University