View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_74 (Length: 236)
Name: NF0342_2D_low_74
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0342_2D_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 98 - 235
Target Start/End: Original strand, 17000151 - 17000288
Alignment:
Q |
98 |
catgcatatgcttatatcatttgcagactcctttgaattaaactggttataaccaccaacaaattgaattgaaatcatagaaaatttcaaagaatcataa |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
17000151 |
catgcatatgcttatatcatttgcagactcctctgaattaaactggttatagccaccaacaaattgaattgaaatcatagaaaattttaaagaatcataa |
17000250 |
T |
 |
Q |
198 |
atcaaacctagtaaatctcagattagtagaataatcta |
235 |
Q |
|
|
|||||| |||||||||||||||||||||||| |||||| |
|
|
T |
17000251 |
atcaaatctagtaaatctcagattagtagaagaatcta |
17000288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University