View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_85 (Length: 210)
Name: NF0342_2D_low_85
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 7e-48; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 87 - 199
Target Start/End: Original strand, 48755644 - 48755756
Alignment:
| Q |
87 |
ttacttgtttgataaaatacaaaagttaacgacctagaaggattcccttgtctcaccctatctgttatcgccattatgagcgattaagccttgaactgta |
186 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48755644 |
ttacttgtttgataaaatgcaaaagttaacgacctagaaggattcccttgtctccccctatctattatcgcctttatgagcgattaagccttgaactgta |
48755743 |
T |
 |
| Q |
187 |
tttgttgatgtcc |
199 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48755744 |
tttgttgatgtcc |
48755756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 48755616 - 48755527
Alignment:
| Q |
1 |
attcagaccttcctacctttatctcttgattccactgcacgatcatctctataccatgtttgacaaccggaaaaaatatatggttattac |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48755616 |
attcagaccttcctacctttatctcttgattccactgcacgatcatctctataccatgtttgacaaccggaaaaaatatatggttattac |
48755527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 11326792 - 11326842
Alignment:
| Q |
5 |
agaccttcctacctttatctcttgattccactgcacgatcatctctatacc |
55 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
11326792 |
agaccttcctgcctttatctcttgattccactgcaagatcatatctatacc |
11326842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 11484813 - 11484863
Alignment:
| Q |
5 |
agaccttcctacctttatctcttgattccactgcacgatcatctctatacc |
55 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
11484813 |
agaccttcctgcctttatctcttgattccactgcaagatcatatctatacc |
11484863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University