View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_high_12 (Length: 307)
Name: NF0342_high_12
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 35949708 - 35949545
Alignment:
| Q |
1 |
taagaggtggtgacgcctatagaagacttgcacaacagcaaaacattctctacatgtttcctaaacaagtatggattggaggggaaagaaaactaggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35949708 |
taagaggtggtgacgcctatagaagacttgcacaccaccaaaacattctctacatgtttcctaaacaagtatggattggaggggaaagaaaactaggaag |
35949609 |
T |
 |
| Q |
101 |
ttggcagacaatttgggtaggcggtgggtgagttccagagaga-gggagataacttctttctca |
163 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||| |||||| ||||||||||||| |
|
|
| T |
35949608 |
ttggcagacaatctgggtaggcggtgggtgagttccagatagatgggagagaacttctttctca |
35949545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University