View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_high_6 (Length: 394)
Name: NF0342_high_6
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 30 - 379
Target Start/End: Complemental strand, 10438688 - 10438339
Alignment:
| Q |
30 |
ctgtatgtgttgttgaattacttggaggtgaaaaccaatctagcagcaattttgttctcgtaaaaaggcccgacgaaggattgcttgccggtctatggga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10438688 |
ctgtatgtgttgttgaattacttggaggtgaaaaccaatctagcagcagatttgttctcgtaaaaaggcccgacgaaggattgcttgccggtttatggga |
10438589 |
T |
|
| Q |
130 |
gtttccgtctgtcttagtagatggagaaactgctccattagctagacgaaaagcaaccgattgtttcttgnnnnnnngtctcaaaattgacatcagaaag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10438588 |
gtttccgtctgtcttagtagatggagaaactgctccattagctagacgaaaagcaaccgattgtttcttgaaaaaaagtctcaaaattgacatcagaaag |
10438489 |
T |
|
| Q |
230 |
acctgcgatgttgttttgagggaagatgtcggggaatttgttcatatttttagtcacattcgcctcaagttgtatgttgagttgctggtgctacaattga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10438488 |
acctgcgatgttgttttgagggaagatgtcggggaatttgttcatatttttagtcacattcgcctcaagttgtatgttgagttgctggtgctacaattga |
10438389 |
T |
|
| Q |
330 |
aaggtttgaacctctttctattatatgccattacaagttgaatttaatct |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10438388 |
aaggtttgaacctctttctattatatgccattacaagttgaatttaatct |
10438339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University