View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_high_9 (Length: 345)
Name: NF0342_high_9
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 241
Target Start/End: Complemental strand, 48397741 - 48397515
Alignment:
| Q |
15 |
gagggagatgattgtctctatcccggagtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatggactttggtagagattgaaga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48397741 |
gagggagatgattgtctctatcccggagtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatgaactttggtagagattgaaga |
48397642 |
T |
|
| Q |
115 |
actgttttttgagcttttgaaggtggaccttcggtgggaatgaagaaggagatttgaagattttgattaagaataataattcttttggcaaattcaatca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397641 |
actgttttttgagcttttgaaggtggaccttcggtgggaatgaagaaggtgatttgaagattttgattaagaataataattcttttggcaaattcaatca |
48397542 |
T |
|
| Q |
215 |
ttggtataagatgtcccatgcctggtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48397541 |
ttggtataagatgtcccatgcctggtg |
48397515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University