View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0342_low_11 (Length: 345)

Name: NF0342_low_11
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0342_low_11
NF0342_low_11
[»] chr7 (1 HSPs)
chr7 (15-241)||(48397515-48397741)


Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 241
Target Start/End: Complemental strand, 48397741 - 48397515
Alignment:
15 gagggagatgattgtctctatcccggagtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatggactttggtagagattgaaga 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
48397741 gagggagatgattgtctctatcccggagtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatgaactttggtagagattgaaga 48397642  T
115 actgttttttgagcttttgaaggtggaccttcggtgggaatgaagaaggagatttgaagattttgattaagaataataattcttttggcaaattcaatca 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
48397641 actgttttttgagcttttgaaggtggaccttcggtgggaatgaagaaggtgatttgaagattttgattaagaataataattcttttggcaaattcaatca 48397542  T
215 ttggtataagatgtcccatgcctggtg 241  Q
    |||||||||||||||||||||||||||    
48397541 ttggtataagatgtcccatgcctggtg 48397515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University