View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_low_12 (Length: 338)
Name: NF0342_low_12
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 99 - 251
Target Start/End: Original strand, 23776638 - 23776787
Alignment:
| Q |
99 |
aaataatgcgattgaagacttggaggttaaccgattggaaaaaattgagaaaacaatcgatgtgaagaaacagtacggtggtaaagtatcagaccctgtg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
23776638 |
aaataatgcgattgaagacttggaggttaaccgattggaagaaattgagaaaacaagcgatgtgaagaaacaatacggcggtaaagtatcagaccctgtg |
23776737 |
T |
|
| Q |
199 |
attacgttgttggcttaaatcatccatcatcatcaggagaaaaacaagaaaag |
251 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
23776738 |
attacgttgttggcttaaataatc---catcatcaggagaaaaacaagaaaag |
23776787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 142 - 227
Target Start/End: Complemental strand, 32298418 - 32298332
Alignment:
| Q |
142 |
attgagaaaacaatcgatgtgaagaaa-cagtacggtggtaaagtatcagaccctgtgattacgttgttggcttaaatcatccatca |
227 |
Q |
| |
|
||||| ||||||| ||||||||| ||| || ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32298418 |
attgacaaaacaagcgatgtgaaaaaaacaatacggcggtaaagtatcagaccatgtgattacgttgttggcttaaatcatccatca |
32298332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University