View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_low_18 (Length: 258)
Name: NF0342_low_18
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0342_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 34910675 - 34910814
Alignment:
Q |
1 |
ttgtgcttctcacacatcacatggtgctaccaataaactggtttcaaagaagacaatttactaagagcaagaaaattaataaaatggaaaaatatcaaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34910675 |
ttgtgcttctcacacatcacatggtgctaccaataaactggtttcaaagaagacaatttactaagagcaagaaaattaataaaatggaaaaatatcaaaa |
34910774 |
T |
 |
Q |
101 |
tttccaatagaaagattacccaaaaccggagttgatgatg |
140 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
34910775 |
tttccaatagaaagattacccaaaaccggagttgaagatg |
34910814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 28542918 - 28542797
Alignment:
Q |
1 |
ttgtgcttctcacacatcacatggtgctaccaataaactggtttcaaag---------aagacaatttactaagagcaagaaaattaataaaatggaaaa |
91 |
Q |
|
|
|||||||||||||| ||||| ||| ||||||||||||||||||||||| |||||| ||| | |||||||||| |||||||||||||| ||| |
|
|
T |
28542918 |
ttgtgcttctcacaaatcacctggcactaccaataaactggtttcaaaggcttccatgaagacagtttgccaagagcaagacaattaataaaatgggaaa |
28542819 |
T |
 |
Q |
92 |
atatcaaaatttccaatagaaa |
113 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
28542818 |
atatcaaaatttccaatagaaa |
28542797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University