View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_low_25 (Length: 234)
Name: NF0342_low_25
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 43535454 - 43535238
Alignment:
| Q |
1 |
ttgaaagactccggcggaggtgacggcgacggtggtggtggtgaccgggatgtggataagaaaaatgagtcgtcgggaccttttcctgattggttgaatt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43535454 |
ttgaaagactccggcggaggtggcggcgacggtggtggtggtgaccgggaggtggataagaaaaatgagtcgtcgggaccttttcctgattggttgaatt |
43535355 |
T |
|
| Q |
101 |
ttacttctgatgatgcgaaaactgtgtttgctgctcttgctatatcacttgcgtttcgtactttcattgctgagcctaggttcattccttccttgtcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43535354 |
ttacttctgatgatgcgaaaactgtgtttgctgctcttgctatatcacttgcgtttcgtactttcattgctgagcctaggttcattccttccttgtcaat |
43535255 |
T |
|
| Q |
201 |
gtatcctacttatgatg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43535254 |
gtatcctacttatgatg |
43535238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University