View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_low_27 (Length: 202)
Name: NF0342_low_27
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0342_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 1734642 - 1734758
Alignment:
Q |
1 |
gagctctttctctctctgtgatcatcatcttcccttgagttccttcttactttgcgatcatcctcttcccttgagttcttcctttctttgcgatcatcct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1734642 |
gagctctttctctctctgtgatcatcatcttcccttgagttccttcttactttgcgatcatcctcttcccttgagttcttcctttctttgcgatcatcct |
1734741 |
T |
 |
Q |
101 |
catacctagagctcttt |
117 |
Q |
|
|
||||||||||| ||||| |
|
|
T |
1734742 |
catacctagagttcttt |
1734758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 1734636 - 1734706
Alignment:
Q |
31 |
tcccttgagttccttcttactttgcgatcatcctcttcccttgagttcttcctttctttgcgatcatcctc |
101 |
Q |
|
|
||||||||| || |||| || || ||||||| ||||||||||||||| | ||| |||||||||||||||| |
|
|
T |
1734636 |
tcccttgagctctttctctctctgtgatcatcatcttcccttgagttccttcttactttgcgatcatcctc |
1734706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University