View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_low_4 (Length: 452)
Name: NF0342_low_4
Description: NF0342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 95 - 307
Target Start/End: Complemental strand, 260297 - 260085
Alignment:
| Q |
95 |
gagataaggctttatgaggaagaatgacattcacggactggttacactttagagattaatgaaccaccctagtttaatgaatgtttattttttcgtgtaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
260297 |
gagataaggctttatgaggaagaatgacattcacagactggttacactttagagattaatgaaccaccctagtttaatgaatgtttattttttcgtgtaa |
260198 |
T |
 |
| Q |
195 |
caattcggcaagctgaacaactttttacgtatatgtatcacacccaaaatgaataaatggaagtagaatttccttttttcattttatggaacggttacct |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
260197 |
caattcggcaagctgaacaactttttacgtatatgtatcacgcccaaaatgaataaatggaagtagaatgtccttttttcattttatggagtggttacct |
260098 |
T |
 |
| Q |
295 |
tattattatttgc |
307 |
Q |
| |
|
||||||||||||| |
|
|
| T |
260097 |
tattattatttgc |
260085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 287 - 418
Target Start/End: Original strand, 259499 - 259630
Alignment:
| Q |
287 |
ggttaccttattattatttgctccttcaatctttcatcatagtccttctcatttgactcaagcacattctctctttcttcaaattgcccctcttttgatt |
386 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||| ||||| |||| ||| ||| |
|
|
| T |
259499 |
ggttactttattattatttgctccttcaatctttcatcaaagtccttctcatttgactcaagcaccttctctctatcttcatattgctcctcctttaatt |
259598 |
T |
 |
| Q |
387 |
tgagttccttccgttggatttcaagtcttgat |
418 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| |
|
|
| T |
259599 |
tgagttccttccattggatttcaaatcttgat |
259630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 348 - 441
Target Start/End: Complemental strand, 260086 - 259989
Alignment:
| Q |
348 |
gcacattctctctttcttcaaattgcccctcttttgatttgagttccttccg----ttggatttcaagtcttgatttatgcttcatcacttgctctct |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
260086 |
gcacattctctctttcttcaaattgcccctcttttgatttgagttccttccgttggttggatttcaagtcttgatttatgcttcatcacttgctctct |
259989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University