View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0343_low_16 (Length: 221)
Name: NF0343_low_16
Description: NF0343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0343_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 214
Target Start/End: Original strand, 23332595 - 23332800
Alignment:
| Q |
9 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
|
| Q |
109 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
|
| Q |
209 |
atctca |
214 |
Q |
| |
|
| |||| |
|
|
| T |
23332795 |
agctca |
23332800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University