View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0350_high_12 (Length: 248)
Name: NF0350_high_12
Description: NF0350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0350_high_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 28 - 248
Target Start/End: Complemental strand, 43102327 - 43102107
Alignment:
| Q |
28 |
acgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgtaaccattgcttcta |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43102327 |
acgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgttaccattgcttcta |
43102228 |
T |
 |
| Q |
128 |
tcgggattctaattcaaactacttcattcatttatgtctttccatcttcacttggattcgccgtttccacccgtgttggaaacgagctaggtgctaaccg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102227 |
tcgggattctaattcaaactacttcattcatttatgtctttccatcttcacttggattcgcagtttccacccgtgttggaaacgagctaggtgctaaccg |
43102128 |
T |
 |
| Q |
228 |
tcctttccaagctaagttatc |
248 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43102127 |
tcctttccaagctaagttatc |
43102107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 72
Target Start/End: Original strand, 24241 - 24282
Alignment:
| Q |
31 |
ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa |
72 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
24241 |
ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa |
24282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 92
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
| Q |
40 |
gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg |
92 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| | ||||| ||||| ||||| |
|
|
| T |
51874979 |
gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg |
51875031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University