View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0350_high_12 (Length: 248)

Name: NF0350_high_12
Description: NF0350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0350_high_12
NF0350_high_12
[»] chr8 (1 HSPs)
chr8 (28-248)||(43102107-43102327)
[»] scaffold0039 (1 HSPs)
scaffold0039 (31-72)||(24241-24282)
[»] chr3 (1 HSPs)
chr3 (40-92)||(51874979-51875031)


Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 28 - 248
Target Start/End: Complemental strand, 43102327 - 43102107
Alignment:
28 acgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgtaaccattgcttcta 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
43102327 acgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgttaccattgcttcta 43102228  T
128 tcgggattctaattcaaactacttcattcatttatgtctttccatcttcacttggattcgccgtttccacccgtgttggaaacgagctaggtgctaaccg 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
43102227 tcgggattctaattcaaactacttcattcatttatgtctttccatcttcacttggattcgcagtttccacccgtgttggaaacgagctaggtgctaaccg 43102128  T
228 tcctttccaagctaagttatc 248  Q
    |||||||||||||||||||||    
43102127 tcctttccaagctaagttatc 43102107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 72
Target Start/End: Original strand, 24241 - 24282
Alignment:
31 ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa 72  Q
    |||||||||||||| || || |||||||||||||||||||||    
24241 ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa 24282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 92
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
40 gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg 92  Q
    ||||| |||||||| |||||||||||||||||| | ||||| ||||| |||||    
51874979 gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg 51875031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University