View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0350_low_6 (Length: 367)
Name: NF0350_low_6
Description: NF0350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0350_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 21 - 360
Target Start/End: Complemental strand, 50530490 - 50530151
Alignment:
| Q |
21 |
acatcatcacacacagaaaaacaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgcta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530490 |
acatcatcacacacagaaaaacaaaaccaaagagcgcacgcaatgacaagccatggctcatcgttttcgagcctcccaaactatctccaagccgtcgcta |
50530391 |
T |
 |
| Q |
121 |
aaactccctctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgcgttcgagctaggtccggtaacagcatgcgcaaaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
50530390 |
aaactccctctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgtgttcgagctaggtccggcaacagcatgcgcaaaag |
50530291 |
T |
 |
| Q |
221 |
cctccgttggtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggccct |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530290 |
cctccgttggtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggccct |
50530191 |
T |
 |
| Q |
321 |
tccgttgttctatcttacgccattgccggtttctgtgctc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530190 |
tccgttgttctatcttacgccattgccggtttctgtgctc |
50530151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University