View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0350_low_9 (Length: 311)
Name: NF0350_low_9
Description: NF0350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0350_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 229 - 300
Target Start/End: Complemental strand, 18905649 - 18905578
Alignment:
| Q |
229 |
tgtactgattgaaaattttgtcgtgcagatcaaggatggatttggtgaaggtaaagatctgattgtgtctgt |
300 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18905649 |
tgtactgattcaaaattttgtcatgcagatcaaggatggatttggtgaaggtaaagatctgattgtgtctgt |
18905578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 81 - 236
Target Start/End: Original strand, 18903691 - 18903845
Alignment:
| Q |
81 |
agaagtaatgattttagattcaagaatgtgagggttaattgt------actaacaattacacttatgtgatgactctcagaaataatcaccaaccacttg |
174 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||||||| |||||||||||||| ||||||| |||||||||||| |||||| ||| |
|
|
| T |
18903691 |
agaagtaatgattttagagtcaagaattcgagcgttaattgttattgtactaacaattacacgtatgtgaggactctcagaaacaatcac-------ttg |
18903783 |
T |
|
| Q |
175 |
tcatgttactgtgatgttctgcattgaataaagattgacagttaaatgaaatactgtactga |
236 |
Q |
| |
|
|||| |||| ||||||||| ||| ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
18903784 |
tcatattacaatgatgttctccatagaataaagattgacagttaaatgaattattgtactga |
18903845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University