View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0351-Insertion-10 (Length: 149)

Name: NF0351-Insertion-10
Description: NF0351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0351-Insertion-10
NF0351-Insertion-10
[»] chr7 (1 HSPs)
chr7 (8-149)||(36941723-36941864)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 36941864 - 36941723
Alignment:
8 gtaacataaatcattgtatcacattaggcatacatcaatgaatcacatgtctaattatagcatccgtttgcaggttgctcgtggatcttatcatttatca 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36941864 gtaacataaatcattgtatcacattaggcatacatcaatgaatcacatgtctaattatagcatccgtttgcaggttgctcgtggatcttatcatttatca 36941765  T
108 gtcgagcaactgaatttctcttctcagcatgagaagttgtct 149  Q
    ||||||||||||||||||||||||||||||||||||||||||    
36941764 gtcgagcaactgaatttctcttctcagcatgagaagttgtct 36941723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University