View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0351-Insertion-3 (Length: 464)
Name: NF0351-Insertion-3
Description: NF0351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0351-Insertion-3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 2e-56; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 130 - 261
Target Start/End: Original strand, 27645040 - 27645166
Alignment:
Q |
130 |
ggttaatgagattttggagtgaagaaggtttgtatttatagaccaaaaaggaacgggccacgcggtgtctcttctcttccttaacagagaagattttaaa |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
27645040 |
ggttaatgagattttggagtgaagaaggtttgtatttatagaccaaaaaggaacgggccacgcggtg-----tctcttccttaacagagaagattttaaa |
27645134 |
T |
 |
Q |
230 |
cccctaaattgatgaacaaaattaggatgggt |
261 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
27645135 |
cccctaaattgatgaacaaaattaggatgggt |
27645166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 323 - 464
Target Start/End: Original strand, 27645227 - 27645368
Alignment:
Q |
323 |
tcagtttatctgtggttaatccaaaatttggtccaaaaatattttttgcgtgtgaattcttaccccttaagatattcctttnnnnnnnnngattttcatt |
422 |
Q |
|
|
|||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||| |||| |||||| ||| |
|
|
T |
27645227 |
tcagtttatctgtggttaattcaaaattcggttcaaaaatattttttgcgtgtgaattcttaccccttaaaatatttcttt-aaaaaaaagatttttatt |
27645325 |
T |
 |
Q |
423 |
aaatgaaaaattaccata-acattatgaatacctttcgtatga |
464 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
27645326 |
gaatgaaaaattaccatatacattatgaatacctttcgtatga |
27645368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 27549588 - 27549634
Alignment:
Q |
130 |
ggttaatgagattttggagtgaagaaggtttgtatttatagaccaaa |
176 |
Q |
|
|
||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
T |
27549588 |
ggttaatgagattttggggtgaagaaggtttgtctttatagaccaaa |
27549634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 27644925 - 27644969
Alignment:
Q |
10 |
gagtttgttcatctccgatgaaatttgttgttctgccattgtttc |
54 |
Q |
|
|
||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
T |
27644925 |
gagtttgttcatctccgatgaaacttgttgttccaccattgtttc |
27644969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 464
Target Start/End: Original strand, 27645499 - 27645551
Alignment:
Q |
413 |
gattttcattaaatgaaaaattaccata-acattatgaatacctttcgtatga |
464 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
T |
27645499 |
gattttcattaaatgaaaaattaccatatacatttcgaataccttttgtatga |
27645551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 15 - 51
Target Start/End: Original strand, 27549426 - 27549462
Alignment:
Q |
15 |
tgttcatctccgatgaaatttgttgttctgccattgt |
51 |
Q |
|
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
T |
27549426 |
tgttcatctctgatgaaacttgttgttctgccattgt |
27549462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University