View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0351-Insertion-7 (Length: 264)
Name: NF0351-Insertion-7
Description: NF0351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0351-Insertion-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 264
Target Start/End: Complemental strand, 43389140 - 43388888
Alignment:
| Q |
13 |
tgcatatacgcttcttctttgtctcaaattaagttaaatatgttggttatttatatccatcttctgaggtgaaatccattttgagatcaaaacggctaaa |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43389140 |
tgcatatacgcttcttctttgtttcaaattaagttaaatatgttggttatttatatccatctcctgaggtgaaatccattttgatatcaaaacggctaaa |
43389041 |
T |
 |
| Q |
113 |
taagctcatatctagttgagaaagattcagctagacttgtttcattttttctattagacaaacaaatcataata-nnnnnnnggagtaaatgataccata |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
43389040 |
taagctcatatctagttgagaaagattcagctagacttgtttcatttttccaattagacaaacaaatcataatattttttttggagtaaataataccata |
43388941 |
T |
 |
| Q |
212 |
tgtccctaactaactagcaaggcatgaagtaattaaaatccagcaataatatt |
264 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
43388940 |
tgtccctaactaactagcaagtcatgatgtaattaaaatccaacaataatatt |
43388888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University