View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0351_high_3 (Length: 327)
Name: NF0351_high_3
Description: NF0351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0351_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 30 - 265
Target Start/End: Complemental strand, 37714679 - 37714444
Alignment:
| Q |
30 |
attggattacagaaaacccgaagttgaatctttagccaaattgtttggagcttttgatgacaaccaaaacgacgacgttcatccccaattgcaatggaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37714679 |
attggattacagaaaacccgaagttgaatctttagccaaattgtttggagcttttgatgacaaccaaaacgacgacgttcatccccaattgcaatggaag |
37714580 |
T |
 |
| Q |
130 |
ctccctcttcatcaccacccagattctcctttccatttggttaatctcccttcagaagaaattgctcgtaacattgctaatcgaagttagttttcaattt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37714579 |
ctccctcttcatcaccacccagattctcctttccatttggttaatctcccttcagaagaaattgctcgtaacattgctaatcgaagttagttttcaattt |
37714480 |
T |
 |
| Q |
230 |
ctctttttcttcattctgaatctctgattatggcta |
265 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37714479 |
ctccttttcttcattctgaatctctgattatggcta |
37714444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 299 - 327
Target Start/End: Complemental strand, 37714410 - 37714382
Alignment:
| Q |
299 |
aacaattattttagcttagccctttaatt |
327 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37714410 |
aacaattattttagcttagccctttaatt |
37714382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University