View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0351_low_6 (Length: 226)
Name: NF0351_low_6
Description: NF0351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0351_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 57 - 213
Target Start/End: Complemental strand, 29967738 - 29967582
Alignment:
Q |
57 |
gctccgagtcctttgggtttatttgactcactccctcctgaaatactcctcaaaatcacaagactattaagccctaaacatgctgccaaactctgcctcg |
156 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
29967738 |
gctccgagtcctttgggtttatttgactcactccctcctgacatactcctcaaaatcacaagactattaggccctaaacatgctgccaaactctgcctcg |
29967639 |
T |
 |
Q |
157 |
tttgcaagtcatggcgatctctcgtctccgataacgaactctgggctcatattcttc |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
29967638 |
tttgcaagtcatggcgatctctcgtctccgataacgaactctgggctcattttcttc |
29967582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University