View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0352-INSERTION-2 (Length: 111)
Name: NF0352-INSERTION-2
Description: NF0352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0352-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 7e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 7e-31
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 21614220 - 21614120
Alignment:
| Q |
8 |
gttttgaatcttgtgagtaaagtttccaaggccattgaaaaaagtgannnnnnnagtagagatgaagagaagagtggatttggtgaaatgggttggtgga |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21614220 |
gttttgaatcttgtgagtaaagtttctaaggccattgaaaaaggtgatttttttagtggagatgaagagaagagtggatttggtgaaatgggttggtgga |
21614121 |
T |
 |
| Q |
108 |
t |
108 |
Q |
| |
|
| |
|
|
| T |
21614120 |
t |
21614120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University