View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0352-INSERTION-4 (Length: 250)
Name: NF0352-INSERTION-4
Description: NF0352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0352-INSERTION-4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 47279075 - 47278835
Alignment:
Q |
8 |
gttaccatgttagtgcttacctttctcacacactttttaaaagtttaattgatatcaacatgataatgcacttagtgagatttgtatcttctctttaatt |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
47279075 |
gttaccatgttagtgcttacctttctcacacactttttaaaagtttaattgatatcaacatgataatgcacttagtgagatttgtatattctctttaatt |
47278976 |
T |
 |
Q |
108 |
gatttcaatttcaacatgagcggattatatctccatcytcttaccattaaaagtttacttgtgtttagttttgctgcggctataattgatcttgataaaa |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47278975 |
gatttcaatttcaacatgagcggattatatctccatcttcttaccattaaaagtttacttgtgtttagttttgctgcggctataattgatcttgataaaa |
47278876 |
T |
 |
Q |
208 |
tttagttttaaaagttagattttgattaaaagtgggatttt |
248 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47278875 |
tttagttttaaaagttagattttgattaaaagtgggatttt |
47278835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University