View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0354_low_4 (Length: 290)
Name: NF0354_low_4
Description: NF0354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0354_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 8e-98; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 27996257 - 27996061
Alignment:
Q |
1 |
tcgagatcgggttcagatctgcgatactgtgtgctcgtgtgtttgatttttgaagttatgatggtttttgtttcagagttgtttcgattgcaatgcgaag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27996257 |
tcgagatcgggttcagatctgcgatactgtgtgttcgtgtgtttgatttttgaagttgtgatggtttttgtttcagagttgtttcgattgcaatgcgaag |
27996158 |
T |
 |
Q |
101 |
aatccaacatgggcgtctgtaacgtatgggatcttcctctgcattgattgctctgctgttcatcgaagtcttggtgttcacatcagtttcgtgaggt |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
T |
27996157 |
aatccaacatgggcgtctgtaacgtatgggatcttcctctgcattgattgctctgctgttcatcgaagtctcggtgttcatatcagtttcgtgaggt |
27996061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 28053559 - 28053363
Alignment:
Q |
1 |
tcgagatcgggttcagatctgcgatactgtgtgctcgtgtgtttgatttttgaagttatgatggtttttgtttcagagttgtttcgattgcaatgcgaag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28053559 |
tcgagatcgggttcagatctgcgatactgtgtgttcgtgtgtttgatttttgaagttgtgatggtttttgtttcagagttgtttcgattgcaatgcgaag |
28053460 |
T |
 |
Q |
101 |
aatccaacatgggcgtctgtaacgtatgggatcttcctctgcattgattgctctgctgttcatcgaagtcttggtgttcacatcagtttcgtgaggt |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
T |
28053459 |
aatccaacatgggcgtctgtaacgtatgggatcttcctctgcattgattgctctgctgttcatcgaagtctcggtgttcatatcagtttcgtgaggt |
28053363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 42 - 197
Target Start/End: Complemental strand, 28003118 - 28002963
Alignment:
Q |
42 |
tttgatttttgaagttatgatggtttttgtttcagagttgtttcgattgcaatgcgaagaatccaacatgggcgtctgtaacgtatgggatcttcctctg |
141 |
Q |
|
|
|||||||||||||| | ||||| |||| |||||||| ||||| ||||||||| ||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
T |
28003118 |
tttgatttttgaagctgtgatgattttggtttcagatgtgttttgattgcaatacgaagaatccaacatgggcatcagtaacatatgggatcttcctctg |
28003019 |
T |
 |
Q |
142 |
cattgattgctctgctgttcatcgaagtcttggtgttcacatcagtttcgtgaggt |
197 |
Q |
|
|
||||||||| |||||||||||||| ||||| |||||||| || ||||| ||||||| |
|
|
T |
28003018 |
cattgattgttctgctgttcatcggagtctcggtgttcatattagttttgtgaggt |
28002963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 42 - 197
Target Start/End: Complemental strand, 28060420 - 28060265
Alignment:
Q |
42 |
tttgatttttgaagttatgatggtttttgtttcagagttgtttcgattgcaatgcgaagaatccaacatgggcgtctgtaacgtatgggatcttcctctg |
141 |
Q |
|
|
|||||||||||||| | ||||| |||| |||||||| ||||| ||||||||| ||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
T |
28060420 |
tttgatttttgaagctgtgatgattttggtttcagatgtgttttgattgcaatacgaagaatccaacatgggcatcagtaacatatgggatcttcctctg |
28060321 |
T |
 |
Q |
142 |
cattgattgctctgctgttcatcgaagtcttggtgttcacatcagtttcgtgaggt |
197 |
Q |
|
|
||||||||| |||||||||||||| ||||| |||||||| || ||||| ||||||| |
|
|
T |
28060320 |
cattgattgttctgctgttcatcggagtctcggtgttcatattagttttgtgaggt |
28060265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University