View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0354_low_6 (Length: 251)

Name: NF0354_low_6
Description: NF0354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0354_low_6
NF0354_low_6
[»] chr1 (2 HSPs)
chr1 (29-180)||(39921280-39921431)
chr1 (201-239)||(39921217-39921255)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 29 - 180
Target Start/End: Complemental strand, 39921431 - 39921280
Alignment:
29 aaatcccactatgagttgcatgtaaaagaaatatacgttctttactaaagaaatatgtacgttaaatgtgaatctgtcggaagtaaaataagtacgttct 128  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
39921431 aaatcccactatgagttgcatgtaaaagaaatgtacgttctttactaaagaaatatgtacgttaaatgtgaatctgtcggaagtaaaataagcacgttct 39921332  T
129 tccccaaagacatcttaatgaaaccaagtaaatactaggaataggagacaaa 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
39921331 tccccaaagacatcttaatgaaaccaagtaaatactaggaataggagacaaa 39921280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 239
Target Start/End: Complemental strand, 39921255 - 39921217
Alignment:
201 atcagttcatgctatatatggttggttcatcatgtatat 239  Q
    |||||||||||||||||||||||||||||||||||||||    
39921255 atcagttcatgctatatatggttggttcatcatgtatat 39921217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University