View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0354_low_6 (Length: 251)
Name: NF0354_low_6
Description: NF0354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0354_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 29 - 180
Target Start/End: Complemental strand, 39921431 - 39921280
Alignment:
| Q |
29 |
aaatcccactatgagttgcatgtaaaagaaatatacgttctttactaaagaaatatgtacgttaaatgtgaatctgtcggaagtaaaataagtacgttct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39921431 |
aaatcccactatgagttgcatgtaaaagaaatgtacgttctttactaaagaaatatgtacgttaaatgtgaatctgtcggaagtaaaataagcacgttct |
39921332 |
T |
 |
| Q |
129 |
tccccaaagacatcttaatgaaaccaagtaaatactaggaataggagacaaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39921331 |
tccccaaagacatcttaatgaaaccaagtaaatactaggaataggagacaaa |
39921280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 239
Target Start/End: Complemental strand, 39921255 - 39921217
Alignment:
| Q |
201 |
atcagttcatgctatatatggttggttcatcatgtatat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39921255 |
atcagttcatgctatatatggttggttcatcatgtatat |
39921217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University