View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0355_low_10 (Length: 288)
Name: NF0355_low_10
Description: NF0355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0355_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 271
Target Start/End: Original strand, 31226561 - 31226802
Alignment:
| Q |
30 |
ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31226561 |
ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc |
31226660 |
T |
|
| Q |
130 |
cgccgcaactttctttgctgctggctttgcagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgctttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31226661 |
cgccgcaactttctttgctgctggctttgcagctgcgactttcttccccggagaagtccttgctgttgtctttgcaacctttgcattaggtttcgctttt |
31226760 |
T |
|
| Q |
230 |
gcagcagttttggccttagaagcagcttttgacttggtagca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31226761 |
gcagcagttttggccttagaagcagcttttgacttggtagca |
31226802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 30 - 247
Target Start/End: Complemental strand, 31173875 - 31173676
Alignment:
| Q |
30 |
ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc |
129 |
Q |
| |
|
|||||||||||||||||||||| | | ||| ||||| ||||||||| |||||||||||||||||||||| ||| ||||||| |||| |||||||||||| |
|
|
| T |
31173875 |
ctcatttccttccccctctcttgatcgcaactttcttagccggagacctaacagtcttagtcttaggcttcacgttcttcactggagttttcttctttgc |
31173776 |
T |
|
| Q |
130 |
cgccgcaactttctttgctgctggctttgcagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgctttt |
229 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31173775 |
------------------tgctggctttgcagttgcaactttcttccctggagaagtccttgtcgttgtctttgcaacctttgcattaggcttcactttc |
31173694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University