View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0355_low_12 (Length: 266)
Name: NF0355_low_12
Description: NF0355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0355_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 29 - 236
Target Start/End: Complemental strand, 45212099 - 45211888
Alignment:
| Q |
29 |
agcagcacagaccatcgaagttagcctcacacccatgaatctttgatgtaaaacagagatttatgtgaattggcccctcttgcctacatccacggaagca |
128 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45212099 |
agcagcacacaccatcgaagttagccacacacccatgaatctttgatgtaaaacagagattgatgtgaattggcacctcttgcctacatccacggaagca |
45212000 |
T |
 |
| Q |
129 |
ccttaacaaatatattcatcatctcaaataaaattaaaa----gaatctatagccgagctcaatatgtatatcactctacaatactcctactcaaaagtt |
224 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45211999 |
ccttaacaaatatattcatcacctcaaataaaattaaaagaatgaatctatagccgagctcaatatgtatatcactctacaatactcctactcaagagtt |
45211900 |
T |
 |
| Q |
225 |
gcaagaaatgat |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45211899 |
gcaagaaatgat |
45211888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 164
Target Start/End: Complemental strand, 15679903 - 15679873
Alignment:
| Q |
134 |
acaaatatattcatcatctcaaataaaatta |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15679903 |
acaaatatattcatcatctcaaataaaatta |
15679873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University