View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0355_low_17 (Length: 211)
Name: NF0355_low_17
Description: NF0355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0355_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 54609036 - 54608918
Alignment:
| Q |
1 |
ctcaatatattaagtgacattcttttaatccacatttgatccccaaataaannnnnnngcttctttgcatatagaaacgggaataaaagaatcttcataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
54609036 |
ctcaatatattaagtgacattcttttaatccacatttgatccccaaataaattcctttgcttctttacatatagaaacgggaataaaagaatcttcttaa |
54608937 |
T |
 |
| Q |
101 |
gtttaactcatttggtaag |
119 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
54608936 |
gtttaactcatttagtaag |
54608918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University