View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0356_high_2 (Length: 431)
Name: NF0356_high_2
Description: NF0356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0356_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 10 - 411
Target Start/End: Complemental strand, 25302463 - 25302062
Alignment:
Q |
10 |
agatgaaggagagagaactcaatgatgaattggctaaggttcatgagagtatggcggcgccaccggttcttgacaatgttagaagccatggaagagtgtg |
109 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25302463 |
agatgaaggagagagaactaaatgatgaattggctaaggttcatgagagtatggcggcgccaccggttcttgacaatgttagaagccatggaagagtgtg |
25302364 |
T |
 |
Q |
110 |
tttgagtaggtcattcatggcagaagagggtacagtttctagttcattcaaggaaacattggagaatttggtgacaaatgctgatgctttgaggactgag |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25302363 |
tttgagtaggtcattcatggcagaagagggtacagtttctagttcattcaaggaaacattggagaatttggtgacaaatgctgatgctttgaggactgag |
25302264 |
T |
 |
Q |
210 |
acagctttgagagttgtgcagatactgaaaccagctcaggttctcaacttttttgttgctgttgctgagcttcagctcaaggttaggtctttgggttttg |
309 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25302263 |
acagctttgagagttgtgcagatactgaaaccagctcaggttctcaacttttttgttgctgttgctgagcttcagctcaaggttaggtctttgggttttg |
25302164 |
T |
 |
Q |
310 |
ataaggatgctcaaagggaaaaccaagggtgaatgaatcatgggaaatttaaggtggtttggttttccttctgtaatacatagggtttagcagtgatgat |
409 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25302163 |
ataaggatgctcagagggaaaaccaagggtgaatgaatcatgggaaatttaaggtggtttggttttccttctgtaatacatagggtttagcagtgatgat |
25302064 |
T |
 |
Q |
410 |
gt |
411 |
Q |
|
|
|| |
|
|
T |
25302063 |
gt |
25302062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University