View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0356_low_11 (Length: 234)

Name: NF0356_low_11
Description: NF0356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0356_low_11
NF0356_low_11
[»] chr1 (2 HSPs)
chr1 (23-234)||(31226568-31226779)
chr1 (23-233)||(31173676-31173868)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 23 - 234
Target Start/End: Original strand, 31226568 - 31226779
Alignment:
23 ccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgccgccgca 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31226568 ccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgccgccgca 31226667  T
123 actttctttgctgctggctttgcagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgcttttgcagcag 222  Q
    ||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
31226668 actttctttgctgctggctttgcagctgcgactttcttccccggagaagtccttgctgttgtctttgcaacctttgcattaggtttcgcttttgcagcag 31226767  T
223 ttttggccttag 234  Q
    ||||||||||||    
31226768 ttttggccttag 31226779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 23 - 233
Target Start/End: Complemental strand, 31173868 - 31173676
Alignment:
23 ccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgccgccgca 122  Q
    ||||||||||||||| |  | ||| ||||| ||||||||| |||||||||||||||||||||| ||| ||||||| |||| ||||||||               
31173868 ccttccccctctcttgatcgcaactttcttagccggagacctaacagtcttagtcttaggcttcacgttcttcactggagttttcttct----------- 31173780  T
123 actttctttgctgctggctttgcagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgcttttgcagcag 222  Q
           |||||||||||||||||| ||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| ||| |||| |||||||    
31173779 -------ttgctgctggctttgcagttgcaactttcttccctggagaagtccttgtcgttgtctttgcaacctttgcattaggcttcactttcgcagcag 31173687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University