View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0356_low_12 (Length: 210)

Name: NF0356_low_12
Description: NF0356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0356_low_12
NF0356_low_12
[»] chr3 (1 HSPs)
chr3 (1-106)||(22193169-22193274)


Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 22193169 - 22193274
Alignment:
1 taccatactttaagtttatttatgctatttcttaatttatttagcaacannnnnnnattaattgtctactttttaaaatcatttcgtttaatatacacaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||| |||||||||||||||||||||||||    
22193169 taccatactttaagtttatttatgctatttcttaatttatttagcaacatttttttattaattgtctacttttttaaatcatttcgtttaatatacacaa 22193268  T
101 atgttt 106  Q
    ||||||    
22193269 atgttt 22193274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University