View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0356_low_12 (Length: 210)
Name: NF0356_low_12
Description: NF0356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0356_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 22193169 - 22193274
Alignment:
| Q |
1 |
taccatactttaagtttatttatgctatttcttaatttatttagcaacannnnnnnattaattgtctactttttaaaatcatttcgtttaatatacacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22193169 |
taccatactttaagtttatttatgctatttcttaatttatttagcaacatttttttattaattgtctacttttttaaatcatttcgtttaatatacacaa |
22193268 |
T |
|
| Q |
101 |
atgttt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
22193269 |
atgttt |
22193274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University