View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0356_low_13 (Length: 209)
Name: NF0356_low_13
Description: NF0356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0356_low_13 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 104 - 209
Target Start/End: Original strand, 9699671 - 9699776
Alignment:
Q |
104 |
aacctgtgcagcagcgtgattcttgccaaggaacaattaaaatctgaactccttaccaaggttggtttgtggagcatcttagaagtagctgatctgatcg |
203 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9699671 |
aacctgtacagcagcgtgattcttgccaaggaacaattaaaatctgaactccttaccaaggttggtttgtggagcatcttagaagtagctgatctgatcg |
9699770 |
T |
 |
Q |
204 |
gtggat |
209 |
Q |
|
|
|||||| |
|
|
T |
9699771 |
gtggat |
9699776 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University