View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0357-Insertion-11 (Length: 273)
Name: NF0357-Insertion-11
Description: NF0357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0357-Insertion-11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 5461181 - 5461220
Alignment:
| Q |
209 |
atgtgattacattcaattaatttattattccaaattatta |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5461181 |
atgtgattacattcaattaatttattatctcaaattatta |
5461220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 194
Target Start/End: Original strand, 14782794 - 14782826
Alignment:
| Q |
162 |
atctctgtagcaccgacacttctgattgaaagc |
194 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
14782794 |
atctctgtagcaccgacacttctgatggaaagc |
14782826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 164 - 192
Target Start/End: Complemental strand, 33598507 - 33598479
Alignment:
| Q |
164 |
ctctgtagcaccgacacttctgattgaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33598507 |
ctctgtagcaccgacacttctgattgaaa |
33598479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University