View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0357-Insertion-13 (Length: 210)
Name: NF0357-Insertion-13
Description: NF0357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0357-Insertion-13 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 210
Target Start/End: Complemental strand, 11370161 - 11369958
Alignment:
Q |
7 |
agatataaagagcttaaacatagaggacaaaaactccatgcccaactgacccgacagctacatataaaataaaacaacacctaatttgcaaaactcaagt |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11370161 |
agatataaagagcttaaacatagaggacaaaaactccatgcccaacagacccgacggctacatataaaataaaacaacacctaatttgcaaaactcaagt |
11370062 |
T |
 |
Q |
107 |
gttactggtacacccgttttcgaaaacaacacatcaatccctgcacctaatgtgtcaaatttcgtcaaaaaatgcaacttcaacttataaacatctcatt |
206 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11370061 |
ggtactggtacacccgttttcgaaaacaacacatcaatccctgcacctaatgtgtcaaatttcgtcaaaaaatgcaacttcaacttataaacatctcatt |
11369962 |
T |
 |
Q |
207 |
acag |
210 |
Q |
|
|
|||| |
|
|
T |
11369961 |
acag |
11369958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University