View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0357_high_2 (Length: 364)
Name: NF0357_high_2
Description: NF0357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0357_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 29 - 188
Target Start/End: Complemental strand, 1425065 - 1424907
Alignment:
| Q |
29 |
acttgcctctatggaatgagccaagtcactccttgcaactcatcttctccctaatccccaatcaaaatacatgtgatgtgagcaacataaaatgaaaaaa |
128 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1425065 |
acttgcctctatg-aatgagccaagtcactccttgcaactcatcttctccctaatccccaatcaaaatacatgtgatgtgagcaacataaaatgcgaaaa |
1424967 |
T |
 |
| Q |
129 |
ccaaattttacaatgaaatgatttgaggcctccctaacttaaaaactttcactgcccatc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1424966 |
ccaaattttacaatgaaatgatttgaggcctccctaacttaaaaactttcactgcccatc |
1424907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 264 - 353
Target Start/End: Complemental strand, 1424831 - 1424742
Alignment:
| Q |
264 |
aatttattgcaagctaacttctaaaaagaaatgtttcactagctaccacttttcattttaccaatggcattcatcctattcttattctct |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1424831 |
aatttattgcaagctaacttctaaaaagaaatgtttcactagctaccacttttcattttaccaatggcattcatcctattcttattctct |
1424742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 50 - 102
Target Start/End: Original strand, 17601295 - 17601347
Alignment:
| Q |
50 |
caagtcactccttgcaactcatcttctccctaatccccaatcaaaatacatgt |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
17601295 |
caagtcactcattgcaactcatcttctccctaattctcaatcaaagtacatgt |
17601347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University