View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0357_high_4 (Length: 242)
Name: NF0357_high_4
Description: NF0357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0357_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 33 - 146
Target Start/End: Original strand, 36885088 - 36885202
Alignment:
Q |
33 |
aggtggggaggacaaaactaaaaagtattgttttgtttt-ttaaaagtattgtgcgtagtgtctaaatagaaaacttttgtcgttgaagaacataatccc |
131 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
36885088 |
aggtggggaggacaaaactaaaaagtattgttttgtttttttaaaagtattgtgcgtagtgtctaaatagaaaacttttgtcgttgaagaacgtaatccc |
36885187 |
T |
 |
Q |
132 |
tgtcaatgaaaatag |
146 |
Q |
|
|
||||||||||||||| |
|
|
T |
36885188 |
tgtcaatgaaaatag |
36885202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University