View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0357_low_5 (Length: 347)
Name: NF0357_low_5
Description: NF0357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0357_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 80 - 251
Target Start/End: Original strand, 36885031 - 36885202
Alignment:
| Q |
80 |
tatcataggctaaatttgtaagttctgaatcctatctcacagccattttagtagctgaggtggggaggacaaaactaaaaagtattgttttgnnnnnnna |
179 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36885031 |
tatcataagctaaatttgtaagttctgaatcctatctcacagccattttagtagctgaggtggggaggacaaaactaaaaagtattgttttgttttttta |
36885130 |
T |
 |
| Q |
180 |
aaagtattgtgcgtagtgtctaaatagaaaacttttgtcgttgaagaacataatccctgtcaatgaaaatag |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36885131 |
aaagtattgtgcgtagtgtctaaatagaaaacttttgtcgttgaagaacgtaatccctgtcaatgaaaatag |
36885202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University