View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0358_high_8 (Length: 316)
Name: NF0358_high_8
Description: NF0358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0358_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 21630326 - 21630105
Alignment:
| Q |
1 |
tttcaattcattctcttttatctttcatttttattttctactgcactgtagttctactatgaaacactcatgtcaacacaatttaacgtaatcacatgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21630326 |
tttcaattcattctcttttatctttcatttttattttctactgtactgtagttctactatgaaacactcatgtcaacacaatttaacgtaatcacatgtg |
21630227 |
T |
 |
| Q |
101 |
ctggtgtcgtgttcgtttcagacaccagacaccacttcaatcagaagcgtcagtgctacatatgtgaatcattgtttacttctttctaactttgttttta |
200 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
21630226 |
ctggtgtcgtgtccgtgtcagacaccagacaccacttcaatcagaagtgtcagtgctacatatgtgaatcattgtttacttctttttaactttgtttcta |
21630127 |
T |
 |
| Q |
201 |
tttgttgtgaaagagagagaaa |
222 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
21630126 |
tttgttgagaaagagagagaaa |
21630105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University