View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0358_low_16 (Length: 309)
Name: NF0358_low_16
Description: NF0358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0358_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 30 - 297
Target Start/End: Original strand, 31226561 - 31226828
Alignment:
Q |
30 |
ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31226561 |
ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc |
31226660 |
T |
 |
Q |
130 |
cgccgcaactttctttgctgctggctttgcagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgctttt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
31226661 |
cgccgcaactttctttgctgctggctttgcagctgcgactttcttccccggagaagtccttgctgttgtctttgcaacctttgcattaggtttcgctttt |
31226760 |
T |
 |
Q |
230 |
gcagcagttttggccttagaagcagcttttgacttggtagcagcgggcttgggctttgtggcaacagc |
297 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
31226761 |
gcagcagttttggccttagaagcagcttttgacttggtagcagcgggcttgggctttgtggcagcagc |
31226828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 30 - 247
Target Start/End: Complemental strand, 31173875 - 31173676
Alignment:
Q |
30 |
ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc |
129 |
Q |
|
|
|||||||||||||||||||||| | | ||| ||||| ||||||||| |||||||||||||||||||||| ||| ||||||| |||| |||||||||||| |
|
|
T |
31173875 |
ctcatttccttccccctctcttgatcgcaactttcttagccggagacctaacagtcttagtcttaggcttcacgttcttcactggagttttcttctttgc |
31173776 |
T |
 |
Q |
130 |
cgccgcaactttctttgctgctggctttgcagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgctttt |
229 |
Q |
|
|
|||||||||||||| ||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| ||| |||| |
|
|
T |
31173775 |
------------------tgctggctttgcagttgcaactttcttccctggagaagtccttgtcgttgtctttgcaacctttgcattaggcttcactttc |
31173694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University