View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0358_low_17 (Length: 287)
Name: NF0358_low_17
Description: NF0358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0358_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 46795841 - 46795649
Alignment:
Q |
1 |
gttttcaaccattggttccaaatgttctctttccctaataatttcccttcttcatcatcttcttcttcttaccctaatagtaccctttcttttctcattg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46795841 |
gttttcaaccattggttccaaatgttctctttccctaataatttcccttcttcatcatcttcttcttcttaccctaatagtaccctttcttttctcattg |
46795742 |
T |
 |
Q |
101 |
acaatcctgaaaataatgattttccaaataacaatactactcttcttgatgattcactactttctattcctttcactacatcaacacatcatgatg |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
46795741 |
acaatcctgaaaataatgattttccaaataacaatactactcttcttgatgattcactactttctattcctttc---acatcaacacatcatgatg |
46795649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University