View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359-Insertion-10 (Length: 142)
Name: NF0359-Insertion-10
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0359-Insertion-10 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 1e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 142
Target Start/End: Original strand, 35689693 - 35689827
Alignment:
Q |
8 |
caagcttctatgaaactgctatgaagttaactcttcaaatatagaaacatgggtggagggttagttggagacaacataggattaaacgaagaggttatnn |
107 |
Q |
|
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35689693 |
caagcttctatgaaactgcaatgaagttaagtcttcaaatatagaaacatgggtggagggttagttggagacaacataggattaaacgaagaggttataa |
35689792 |
T |
 |
Q |
108 |
nnnnnncatgtagtttgtcttttaaagctcacaac |
142 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
35689793 |
aaaaagcatgtagtttgtcttttaaagctcacaac |
35689827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 6e-26
Query Start/End: Original strand, 43 - 142
Target Start/End: Complemental strand, 35683286 - 35683187
Alignment:
Q |
43 |
caaatatagaaacatgggtggagggttagttggagacaacataggattaaacgaagaggttatnnnnnnnncatgtagtttgtcttttaaagctcacaac |
142 |
Q |
|
|
|||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
T |
35683286 |
caaagatagaaacatgggaggaggattagttggagacaacataggattaaacgaagaggttataaaaaaaacatgtagtttgtctttcaaagctcacaac |
35683187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 689 times since January 2019
Visitors: 3064