View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359-Insertion-5 (Length: 226)
Name: NF0359-Insertion-5
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 5952529 - 5952309
Alignment:
| Q |
9 |
gcaagcacagtttctacctcttgcccaactattagttcacgaggggagtttaaaa-atcatccacattaaattgagagtaatcacaca--taagttagac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
5952529 |
gcaagcacagtttctacctcttgcccaactattaattcacgaggggagtttaaaagatcatccacattaaattcagagtaatcacacaaataagttagac |
5952430 |
T |
|
| Q |
106 |
accacactaatatcccataaattctgatcgaccctcaacgctaattttattatatatgacacttccccacccaaaatgttcttacaagaacatttatcaa |
205 |
Q |
| |
|
||| || ||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5952429 |
accgcattaatatcccataagttcttatcgaccctcaacactaattttattatatatgacacttccccacccaaaatgttcttacaagaacatttatcaa |
5952330 |
T |
|
| Q |
206 |
taacattacatttgacatgat |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5952329 |
taacattacatttgacatgat |
5952309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 501 times since January 2019
Visitors: 3060