View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0359-Insertion-7 (Length: 222)
Name: NF0359-Insertion-7
Description: NF0359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0359-Insertion-7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 7 - 222
Target Start/End: Original strand, 26608947 - 26609161
Alignment:
| Q |
7 |
atgtctctcatttataaactcattttccagttttatctcctcttaatttggtgacatttagaagnnnnnnnnnnnacctaaagagggaatatgactacat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
26608947 |
atgtctctcatttataaactcattttccagttttatctcctcttaacttggtgacatttagaagtttttttttt-acctaaagaggaaatatgactacat |
26609045 |
T |
|
| Q |
107 |
tcataacctgatcttaatatttagacaaacacttgttttattataaccatgattttaaacaaagcttccctatcgtgaccataaactaaggttctgaata |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609046 |
tcataagctgatcttaatatttagacaaacacttgttttattataaccatgattttaaacaaagcttccctatcgtgaccataaactaaggttctgaata |
26609145 |
T |
|
| Q |
207 |
tctataatagttttag |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26609146 |
tctataatagttttag |
26609161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 491 times since January 2019
Visitors: 3060